Localised Sex, Contingency and Mutator Genes. Bacterial Genetics as a Metaphor for Computing Systems
|
|
|
- Penelope Summers
- 9 years ago
- Views:
Transcription
1 Localised Sex, Contingency and Mutator Genes Bacterial Genetics as a Metaphor for Computing Systems
2 Outline Living Systems as metaphors Evolutionary mechanisms Mutation Sex and Localized sex Contingent gene expression Applications
3 Genetic Programming Genetically breeding population of programs using principles of Darwinian natural selection and biologically-inspired operations Fitness evaluation, Darwinian selection Genetic operations Mutation Crossover (sexual recombination) Reproduction Architecture-Alteration (deletion/duplication)
4 Adaptation and Optimization Natural adaptation normally sub-optimal High wastage in natural systems Apparently optimal behaviour for an individual can lead to resource depletion and extinction of the group (density dependence of fitness) Local selection sensitivity of selection to local environment and resources
5 Tree of Life Domains arranged by sequence distance
6 Evolution why bacteria as models/metaphors Single point of all life on Earth 3 primary domains Archaea slowly evolving Bacteria - intermediate Eukarya rapidly evolving (fast clocks) Most diversity in Bacteria and Archaea. (Animals, plants minor components in terms of sequence space.) Flexible adaptive genetic systems Bacterial and archael endosymbionts of eukarya
7 Consequences of Asexual Reproduction Mutation Clonal Population: highly structured with low diversity, bottlenecking, back mutations
8 Mutation and mutator genes In asexual reproduction, novelty introduced mainly by mutation Background mutation rates ~1 x 10-7 per cell per generation but many silent mutations high rates of mutation allow population to track environmental changes quickly, but at a cost strong mutators - genes that raise mutation rates in nearby genes harmful mutations tolerated if environmental conditions favour mutants. Can gain genetic novelty in less costly ways than mutation Recombination/sex. Contingent gene systems (focus variation) Simulations suggest recombination generates diversity more often than even strong mutators.
9 Horizontal Genetic Exchange Original genotype Mutation Recombinant genotype Horizontal Gene transfer (Localised Sex) Mutant genotype Changes population structure: generates genetic diversity (new mosaic genes, reassortment of genes, sharing of genes)
10 Sex and Bacteria - Diversity and Population Structures High Sexual Helicobacter pylori Asexual Salmonella enterica E. coli Diversity Neisseria meningitidis Low N. gonorrhoeae M. tuberculosis Low Clonality High
11 Structured diversity in Bacterial Populations Gene Pool Genetic Exchange Mutation Selection Bacterial Diversity Stochastic Events
12 Adaptative strategies for environmental change Conventional gene regulation expression of genes switched on and off in response to an environmental stimulus. Individual-based but population responds co-ordinately. Contingent Gene expression series of genes are switched ON/OFF or UP/DOWN-regulated randomly. Population-based, but individuals have phenotype (expressed characteristics ) for any eventuality. Suitable phenotype selected.
13 Variation - Contingeny Phase Variation - quantitative changes in transcription or translation On-Off Volume Antigenic Variation - qualitative changes in a single gene or multiple phase variation in related genes Antigenic / structural changes Functional changes Stochastic genetic switching followed by selection
14 A Combinatorial Strategy for Adaptation to Contingencies Consider a hypothetical bacterial pathogen with 2000 genes, 7 of which are controlled by reversible binary switches e.g. A <-> a operating at 10-3 per bacterium per generation. If each gene switches independently = 128 phenotypic possibilities. Suppose a pathogen requires phenotypes: a,b,c,d,e,f,g - for colonisation of its host A,b,c,d,e,F,G - for invasion and survival in host Switching to favoured (invasion) phenotype = 1 in cells.
15 Contingency in pathogen colonization/invasion Exterior Host Colonization abcde (Migration) abcde AbCDe AbCDe abcde Survival Penetration Survival Epithelial/Endothelial barrier
16 Gene Expression from Contingency Loci Hypermutable loci typically encoding surface molecules (e.g. adhesins, invasins) in pathogens Focus change differentially in genome Large repertoire of phenotypes explored, but minimises deleterious effects on fitness Often controlled by reversible binary genetic switches (On-Off, qualitative or quantitative) Slipped stand mispairing Duplication, deletion or inversion Site-specific recombination or hot-spots for generalized recombination Switching rates higher than spontaneous mutation ~ 10-3 per cell/generation cf
17 Capsule Phase Variation by translational frameshifting in the Neisseria meningitidis siad gene 1 89 NON-CAPSULATE ATG... TTACCCCCCCCACGTAA... (OFF) Invasive, serum-sensitive n=8 stop CAPSULATE ATG... TTACCCCCCCACGT...IN FRAME (ON) Non-invasive, serum-resistant 10-3 n= NON-CAPSULATE ATG... TTACCCCCCACGTAA....TTAG (OFF) Invasive, serum-sensitive n=6 stop
18 Slipped-Strand Mispairing Parental strands Replicating chromosome Daughter strands Directly repeated region n = 8 n = 9 +1 Insertion in half progeny chromosomes i.e. those deriving from daughter strand -1 Deletion in half progeny chromosomes i.e. those deriving from daughter strand DR in progeny chromosomes n = 7 n = 8
19 Contingency Slipped Stand Mispairing Amplitude/ Promoter strength ON OFF Frequency of repeat
20 Invertible control of Type 1 fimbrial production in E. coli 314bp fimb fime invertible segment fima On Phase Off Phase FimB FimE DNA Inversion IHF H-NS 314bp invertible segment fimb fime fima
21 A B C PilVA A B C D Rci A B D C PilVA A B C The ColIb Shufflon PilVB, PilVB etc..
22 Shufflon A B C D E F A B D E F
23 Silent and Expression Pillin loci in pathogenic Neisseria C SV HV SV HV C C C Silent Sites HV SV C SV C C HV pile Expression Site C C
24 Virtual bacteria - COSMIC With Ray Paton, Costas Vlachos, Richard Gregory, Henry Wu Developing virtual bacteria (represented by agents) able to interact and evolve in response to changing environments. Inform novel computing architectures Inform modelling of complex biological processes
25 Information flow in biological systems DNA RNA Protein Genes Metabolites Metabolic Cycles Rules? Function/Activity
26 Potential Biological Applications for Rule based Models Evolutionary modelling Minimal genomes and their expression Modelling microbial processes and ecology e.g. Epidemiology of infectious diseases Antibiotic resistance Biogeochemical cycles
Milestones of bacterial genetic research:
Milestones of bacterial genetic research: 1944 Avery's pneumococcal transformation experiment shows that DNA is the hereditary material 1946 Lederberg & Tatum describes bacterial conjugation using biochemical
Mechanisms of Evolution
page 2 page 3 Teacher's Notes Mechanisms of Evolution Grades: 11-12 Duration: 28 mins Summary of Program Evolution is the gradual change that can be seen in a population s genetic composition, from one
Evolution (18%) 11 Items Sample Test Prep Questions
Evolution (18%) 11 Items Sample Test Prep Questions Grade 7 (Evolution) 3.a Students know both genetic variation and environmental factors are causes of evolution and diversity of organisms. (pg. 109 Science
Innovations in Molecular Epidemiology
Innovations in Molecular Epidemiology Molecular Epidemiology Measure current rates of active transmission Determine whether recurrent tuberculosis is attributable to exogenous reinfection Determine whether
Structure and Function of DNA
Structure and Function of DNA DNA and RNA Structure DNA and RNA are nucleic acids. They consist of chemical units called nucleotides. The nucleotides are joined by a sugar-phosphate backbone. The four
Name Class Date. Figure 13 1. 2. Which nucleotide in Figure 13 1 indicates the nucleic acid above is RNA? a. uracil c. cytosine b. guanine d.
13 Multiple Choice RNA and Protein Synthesis Chapter Test A Write the letter that best answers the question or completes the statement on the line provided. 1. Which of the following are found in both
BioBoot Camp Genetics
BioBoot Camp Genetics BIO.B.1.2.1 Describe how the process of DNA replication results in the transmission and/or conservation of genetic information DNA Replication is the process of DNA being copied before
1 Mutation and Genetic Change
CHAPTER 14 1 Mutation and Genetic Change SECTION Genes in Action KEY IDEAS As you read this section, keep these questions in mind: What is the origin of genetic differences among organisms? What kinds
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program
Cystic Fibrosis Webquest Sarah Follenweider, The English High School 2009 Summer Research Internship Program Introduction: Cystic fibrosis (CF) is an inherited chronic disease that affects the lungs and
LECTURE 6 Gene Mutation (Chapter 16.1-16.2)
LECTURE 6 Gene Mutation (Chapter 16.1-16.2) 1 Mutation: A permanent change in the genetic material that can be passed from parent to offspring. Mutant (genotype): An organism whose DNA differs from the
MDM. Metabolic Drift Mutations - Attenuation Technology
MDM Metabolic Drift Mutations - Attenuation Technology Seite 2 Origin of MDM attenuation technology Prof. Dr. Klaus Linde Pioneer in R&D of human and animal vaccines University of Leipzig Germany Origin
FAQs: Gene drives - - What is a gene drive?
FAQs: Gene drives - - What is a gene drive? During normal sexual reproduction, each of the two versions of a given gene has a 50 percent chance of being inherited by a particular offspring (Fig 1A). Gene
Genetics Lecture Notes 7.03 2005. Lectures 1 2
Genetics Lecture Notes 7.03 2005 Lectures 1 2 Lecture 1 We will begin this course with the question: What is a gene? This question will take us four lectures to answer because there are actually several
AP BIOLOGY 2010 SCORING GUIDELINES (Form B)
AP BIOLOGY 2010 SCORING GUIDELINES (Form B) Question 2 Certain human genetic conditions, such as sickle cell anemia, result from single base-pair mutations in DNA. (a) Explain how a single base-pair mutation
The sequence of bases on the mrna is a code that determines the sequence of amino acids in the polypeptide being synthesized:
Module 3F Protein Synthesis So far in this unit, we have examined: How genes are transmitted from one generation to the next Where genes are located What genes are made of How genes are replicated How
AP Biology Essential Knowledge Student Diagnostic
AP Biology Essential Knowledge Student Diagnostic Background The Essential Knowledge statements provided in the AP Biology Curriculum Framework are scientific claims describing phenomenon occurring in
Genetics Module B, Anchor 3
Genetics Module B, Anchor 3 Key Concepts: - An individual s characteristics are determines by factors that are passed from one parental generation to the next. - During gamete formation, the alleles for
Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism )
Biology 1406 Exam 3 Notes Structure of DNA Ch. 10 Genetic information (DNA) determines structure of proteins DNA RNA proteins cell structure 3.11 3.15 enzymes control cell chemistry ( metabolism ) Proteins
Transmission of genetic variation: conjugation. Transmission of genetic variation: conjugation
Transmission of genetic variation: conjugation Transmission of genetic variation: conjugation Bacterial Conjugation is genetic recombination in which there is a transfer of DNA from a living donor bacterium
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15
Biology 1406 - Notes for exam 5 - Population genetics Ch 13, 14, 15 Species - group of individuals that are capable of interbreeding and producing fertile offspring; genetically similar 13.7, 14.2 Population
Biological Sciences Initiative. Human Genome
Biological Sciences Initiative HHMI Human Genome Introduction In 2000, researchers from around the world published a draft sequence of the entire genome. 20 labs from 6 countries worked on the sequence.
Biotechnology: DNA Technology & Genomics
Chapter 20. Biotechnology: DNA Technology & Genomics 2003-2004 The BIG Questions How can we use our knowledge of DNA to: diagnose disease or defect? cure disease or defect? change/improve organisms? What
MUTATION, DNA REPAIR AND CANCER
MUTATION, DNA REPAIR AND CANCER 1 Mutation A heritable change in the genetic material Essential to the continuity of life Source of variation for natural selection New mutations are more likely to be harmful
CCR Biology - Chapter 9 Practice Test - Summer 2012
Name: Class: Date: CCR Biology - Chapter 9 Practice Test - Summer 2012 Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Genetic engineering is possible
4. DNA replication Pages: 979-984 Difficulty: 2 Ans: C Which one of the following statements about enzymes that interact with DNA is true?
Chapter 25 DNA Metabolism Multiple Choice Questions 1. DNA replication Page: 977 Difficulty: 2 Ans: C The Meselson-Stahl experiment established that: A) DNA polymerase has a crucial role in DNA synthesis.
Summary. 16 1 Genes and Variation. 16 2 Evolution as Genetic Change. Name Class Date
Chapter 16 Summary Evolution of Populations 16 1 Genes and Variation Darwin s original ideas can now be understood in genetic terms. Beginning with variation, we now know that traits are controlled by
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE Q5B
INTERNATIONAL CONFERENCE ON HARMONISATION OF TECHNICAL REQUIREMENTS FOR REGISTRATION OF PHARMACEUTICALS FOR HUMAN USE ICH HARMONISED TRIPARTITE GUIDELINE QUALITY OF BIOTECHNOLOGICAL PRODUCTS: ANALYSIS
European Medicines Agency
European Medicines Agency July 1996 CPMP/ICH/139/95 ICH Topic Q 5 B Quality of Biotechnological Products: Analysis of the Expression Construct in Cell Lines Used for Production of r-dna Derived Protein
Genetic Variation and Molecular Evolution
1 Genetic Variation and Molecular Evolution Werner Arber Biozentrum, University of Basel, Klingelbergstrasse 70, Basel, Switzerland 1 Introduction 3 2 Principles of Molecular Evolution 4 2.1 Evolutionary
Gene mutation and molecular medicine Chapter 15
Gene mutation and molecular medicine Chapter 15 Lecture Objectives What Are Mutations? How Are DNA Molecules and Mutations Analyzed? How Do Defective Proteins Lead to Diseases? What DNA Changes Lead to
A and B are not absolutely linked. They could be far enough apart on the chromosome that they assort independently.
Name Section 7.014 Problem Set 5 Please print out this problem set and record your answers on the printed copy. Answers to this problem set are to be turned in to the box outside 68-120 by 5:00pm on Friday
Chapter 4 The role of mutation in evolution
Chapter 4 The role of mutation in evolution Objective Darwin pointed out the importance of variation in evolution. Without variation, there would be nothing for natural selection to act upon. Any change
Genetics Test Biology I
Genetics Test Biology I Multiple Choice Identify the choice that best completes the statement or answers the question. 1. Avery s experiments showed that bacteria are transformed by a. RNA. c. proteins.
Okami Study Guide: Chapter 3 1
Okami Study Guide: Chapter 3 1 Chapter in Review 1. Heredity is the tendency of offspring to resemble their parents in various ways. Genes are units of heredity. They are functional strands of DNA grouped
Chapter 13: Meiosis and Sexual Life Cycles
Name Period Chapter 13: Meiosis and Sexual Life Cycles Concept 13.1 Offspring acquire genes from parents by inheriting chromosomes 1. Let s begin with a review of several terms that you may already know.
Bob Jesberg. Boston, MA April 3, 2014
DNA, Replication and Transcription Bob Jesberg NSTA Conference Boston, MA April 3, 2014 1 Workshop Agenda Looking at DNA and Forensics The DNA, Replication i and Transcription i Set DNA Ladder The Double
DNA Insertions and Deletions in the Human Genome. Philipp W. Messer
DNA Insertions and Deletions in the Human Genome Philipp W. Messer Genetic Variation CGACAATAGCGCTCTTACTACGTGTATCG : : CGACAATGGCGCT---ACTACGTGCATCG 1. Nucleotide mutations 2. Genomic rearrangements 3.
Chapter 6 DNA Replication
Chapter 6 DNA Replication Each strand of the DNA double helix contains a sequence of nucleotides that is exactly complementary to the nucleotide sequence of its partner strand. Each strand can therefore
restriction enzymes 350 Home R. Ward: Spring 2001
restriction enzymes 350 Home Restriction Enzymes (endonucleases): molecular scissors that cut DNA Properties of widely used Type II restriction enzymes: recognize a single sequence of bases in dsdna, usually
Principles of Evolution - Origin of Species
Theories of Organic Evolution X Multiple Centers of Creation (de Buffon) developed the concept of "centers of creation throughout the world organisms had arisen, which other species had evolved from X
Deterministic computer simulations were performed to evaluate the effect of maternallytransmitted
Supporting Information 3. Host-parasite simulations Deterministic computer simulations were performed to evaluate the effect of maternallytransmitted parasites on the evolution of sex. Briefly, the simulations
Human Genome and Human Genome Project. Louxin Zhang
Human Genome and Human Genome Project Louxin Zhang A Primer to Genomics Cells are the fundamental working units of every living systems. DNA is made of 4 nucleotide bases. The DNA sequence is the particular
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes
ISTEP+: Biology I End-of-Course Assessment Released Items and Scoring Notes Page 1 of 22 Introduction Indiana students enrolled in Biology I participated in the ISTEP+: Biology I Graduation Examination
RETRIEVING SEQUENCE INFORMATION. Nucleotide sequence databases. Database search. Sequence alignment and comparison
RETRIEVING SEQUENCE INFORMATION Nucleotide sequence databases Database search Sequence alignment and comparison Biological sequence databases Originally just a storage place for sequences. Currently the
A Hands-On Exercise To Demonstrate Evolution
HOW-TO-DO-IT A Hands-On Exercise To Demonstrate Evolution by Natural Selection & Genetic Drift H ELEN J. YOUNG T RUMAN P. Y OUNG Although students learn (i.e., hear about) the components of evolution by
Given these characteristics of life, which of the following objects is considered a living organism? W. X. Y. Z.
Cell Structure and Organization 1. All living things must possess certain characteristics. They are all composed of one or more cells. They can grow, reproduce, and pass their genes on to their offspring.
Lecture 3: Mutations
Lecture 3: Mutations Recall that the flow of information within a cell involves the transcription of DNA to mrna and the translation of mrna to protein. Recall also, that the flow of information between
Continuous and discontinuous variation
Continuous and discontinuous variation Variation, the small differences that exist between individuals, can be described as being either discontinuous or continuous. Discontinuous variation This is where
Practice Problems 4. (a) 19. (b) 36. (c) 17
Chapter 10 Practice Problems Practice Problems 4 1. The diploid chromosome number in a variety of chrysanthemum is 18. What would you call varieties with the following chromosome numbers? (a) 19 (b) 36
Bio 102 Practice Problems Genetic Code and Mutation
Bio 102 Practice Problems Genetic Code and Mutation Multiple choice: Unless otherwise directed, circle the one best answer: 1. Beadle and Tatum mutagenized Neurospora to find strains that required arginine
NOVA SOUTHEASTERN UNIVERSITY. Bacterial Evolutionary Genetics Course Graduate Level Oceanographic Center NOVA Southeastern University
NOVA SOUTHEAST UNIVERSITY Bacterial Evolutionary Genetics Course Graduate Level Oceanographic Center NOVA Southeastern University Lecture Time: Location: Instructor: Telephone: ON-LINE SUMMER SESSION May
DNA Replication & Protein Synthesis. This isn t a baaaaaaaddd chapter!!!
DNA Replication & Protein Synthesis This isn t a baaaaaaaddd chapter!!! The Discovery of DNA s Structure Watson and Crick s discovery of DNA s structure was based on almost fifty years of research by other
Genetic Algorithm. Based on Darwinian Paradigm. Intrinsically a robust search and optimization mechanism. Conceptual Algorithm
24 Genetic Algorithm Based on Darwinian Paradigm Reproduction Competition Survive Selection Intrinsically a robust search and optimization mechanism Slide -47 - Conceptual Algorithm Slide -48 - 25 Genetic
Restriction Endonucleases
Nucleic Acids and Molecular Biology 14 Restriction Endonucleases Bearbeitet von Alfred Pingoud 1. Auflage 2004. Buch. xxvi, 443 S. Hardcover ISBN 978 3 540 20502 9 Format (B x L): 15,5 x 23,5 cm Gewicht:
Transfection-Transfer of non-viral genetic material into eukaryotic cells. Infection/ Transduction- Transfer of viral genetic material into cells.
Transfection Key words: Transient transfection, Stable transfection, transfection methods, vector, plasmid, origin of replication, reporter gene/ protein, cloning site, promoter and enhancer, signal peptide,
A Primer of Genome Science THIRD
A Primer of Genome Science THIRD EDITION GREG GIBSON-SPENCER V. MUSE North Carolina State University Sinauer Associates, Inc. Publishers Sunderland, Massachusetts USA Contents Preface xi 1 Genome Projects:
Worksheet: The theory of natural selection
Worksheet: The theory of natural selection Senior Phase Grade 7-9 Learning area: Natural Science Strand: Life and living Theme: Biodiversity, change and continuity Specific Aim 1: Acquiring knowledge of
Introduction. What is Ecological Genetics?
1 Introduction What is Ecological enetics? Ecological genetics is at the interface of ecology, evolution, and genetics, and thus includes important elements from each of these fields. We can use two closely
Gene Switches Teacher Information
STO-143 Gene Switches Teacher Information Summary Kit contains How do bacteria turn on and turn off genes? Students model the action of the lac operon that regulates the expression of genes essential for
Basic Concepts Recombinant DNA Use with Chapter 13, Section 13.2
Name Date lass Master 19 Basic oncepts Recombinant DN Use with hapter, Section.2 Formation of Recombinant DN ut leavage Splicing opyright lencoe/mcraw-hill, a division of he Mcraw-Hill ompanies, Inc. Bacterial
Genetics 301 Sample Final Examination Spring 2003
Genetics 301 Sample Final Examination Spring 2003 50 Multiple Choice Questions-(Choose the best answer) 1. A cross between two true breeding lines one with dark blue flowers and one with bright white flowers
(D) 181-183, 186-187, 190-193 TFYI 187 TPK 190
NEVADA Life Science Content Standards for Grade 8 Life s Structure and Function A From Bacteria to Plants B Animal Diversity C Human Body Systems D OBJECTIVES Content Standard 6.0: Structure and Function
DNA, RNA, Protein synthesis, and Mutations. Chapters 12-13.3
DNA, RNA, Protein synthesis, and Mutations Chapters 12-13.3 1A)Identify the components of DNA and explain its role in heredity. DNA s Role in heredity: Contains the genetic information of a cell that can
a. Ribosomal RNA rrna a type ofrna that combines with proteins to form Ribosomes on which polypeptide chains of proteins are assembled
Biology 101 Chapter 14 Name: Fill-in-the-Blanks Which base follows the next in a strand of DNA is referred to. as the base (1) Sequence. The region of DNA that calls for the assembly of specific amino
Immunology Ambassador Guide (updated 2014)
Immunology Ambassador Guide (updated 2014) Immunity and Disease We will talk today about the immune system and how it protects us from disease. Also, we ll learn some unique ways that our immune system
Name Class Date. binomial nomenclature. MAIN IDEA: Linnaeus developed the scientific naming system still used today.
Section 1: The Linnaean System of Classification 17.1 Reading Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN IDEA:
Respiration occurs in the mitochondria in cells.
B3 Question Which process occurs in the mitochondria in cells? Why do the liver and muscle cells have large number of mitochondria? What is the function of the ribosomes? Answer Respiration occurs in the
AS Biology Unit 2 Key Terms and Definitions. Make sure you use these terms when answering exam questions!
AS Biology Unit 2 Key Terms and Definitions Make sure you use these terms when answering exam questions! Chapter 7 Variation 7.1 Random Sampling Sampling a population to eliminate bias e.g. grid square
Gene Mapping Techniques
Gene Mapping Techniques OBJECTIVES By the end of this session the student should be able to: Define genetic linkage and recombinant frequency State how genetic distance may be estimated State how restriction
List, describe, diagram, and identify the stages of meiosis.
Meiosis and Sexual Life Cycles In this topic we will examine a second type of cell division used by eukaryotic cells: meiosis. In addition, we will see how the 2 types of eukaryotic cell division, mitosis
Bio EOC Topics for Cell Reproduction: Bio EOC Questions for Cell Reproduction:
Bio EOC Topics for Cell Reproduction: Asexual vs. sexual reproduction Mitosis steps, diagrams, purpose o Interphase, Prophase, Metaphase, Anaphase, Telophase, Cytokinesis Meiosis steps, diagrams, purpose
Practice Questions 1: Evolution
Practice Questions 1: Evolution 1. Which concept is best illustrated in the flowchart below? A. natural selection B. genetic manipulation C. dynamic equilibrium D. material cycles 2. The diagram below
Y Chromosome Markers
Y Chromosome Markers Lineage Markers Autosomal chromosomes recombine with each meiosis Y and Mitochondrial DNA does not This means that the Y and mtdna remains constant from generation to generation Except
(1-p) 2. p(1-p) From the table, frequency of DpyUnc = ¼ (p^2) = #DpyUnc = p^2 = 0.0004 ¼(1-p)^2 + ½(1-p)p + ¼(p^2) #Dpy + #DpyUnc
Advanced genetics Kornfeld problem set_key 1A (5 points) Brenner employed 2-factor and 3-factor crosses with the mutants isolated from his screen, and visually assayed for recombination events between
Understanding the dynamics and function of cellular networks
Understanding the dynamics and function of cellular networks Cells are complex systems functionally diverse elements diverse interactions that form networks signal transduction-, gene regulatory-, metabolic-
KEY CONCEPT Organisms can be classified based on physical similarities. binomial nomenclature
Section 17.1: The Linnaean System of Classification Unit 9 Study Guide KEY CONCEPT Organisms can be classified based on physical similarities. VOCABULARY taxonomy taxon binomial nomenclature genus MAIN
Chapter 3. Chapter Outline. Chapter Outline 9/11/10. Heredity and Evolu4on
Chapter 3 Heredity and Evolu4on Chapter Outline The Cell DNA Structure and Function Cell Division: Mitosis and Meiosis The Genetic Principles Discovered by Mendel Mendelian Inheritance in Humans Misconceptions
How Cancer Begins???????? Chithra Manikandan Nov 2009
Cancer Cancer is one of the most common diseases in the developed world: 1 in 4 deaths are due to cancer 1 in 17 deaths are due to lung cancer Lung cancer is the most common cancer in men Breast cancer
Mutations: 2 general ways to alter DNA. Mutations. What is a mutation? Mutations are rare. Changes in a single DNA base. Change a single DNA base
Mutations Mutations: 2 general ways to alter DNA Change a single DNA base Or entire sections of DNA can move from one place to another What is a mutation? Any change in the nucleotide sequence of DNA Here
AP Biology Syllabus 2012-2013
n AP Biology, an emphasis is on students making connections between the big ideas within the AP Biology Curriculum Framework. he two main goals of AP Biology are to help students develop a conceptual framework
High School Science Course Correlations between Ohio s 2010 Course Syllabi and the First Draft of the High School NGSS
High School Science Course Correlations between Ohio s 2010 Course Syllabi and the First Draft of the High School NGSS This document correlates the content in Ohio s course syllabi with the performance
Activity 7.21 Transcription factors
Purpose To consolidate understanding of protein synthesis. To explain the role of transcription factors and hormones in switching genes on and off. Play the transcription initiation complex game Regulation
Recombinant DNA and Biotechnology
Recombinant DNA and Biotechnology Chapter 18 Lecture Objectives What Is Recombinant DNA? How Are New Genes Inserted into Cells? What Sources of DNA Are Used in Cloning? What Other Tools Are Used to Study
Bacteria: The good, the bad, and the ugly. SEPA BioScience Montana Module 2
Bacteria: The good, the bad, and the ugly. SEPA BioScience Montana Module 2 Introduction: The following reading will give you a basic introduction to bacteria and their role in illness. It will explore
Evolution, Natural Selection, and Adaptation
Evolution, Natural Selection, and Adaptation Nothing in biology makes sense except in the light of evolution. (Theodosius Dobzhansky) Charles Darwin (1809-1882) Voyage of HMS Beagle (1831-1836) Thinking
CPO Science and the NGSS
CPO Science and the NGSS It is no coincidence that the performance expectations in the Next Generation Science Standards (NGSS) are all action-based. The NGSS champion the idea that science content cannot
Protein Synthesis. Page 41 Page 44 Page 47 Page 42 Page 45 Page 48 Page 43 Page 46 Page 49. Page 41. DNA RNA Protein. Vocabulary
Protein Synthesis Vocabulary Transcription Translation Translocation Chromosomal mutation Deoxyribonucleic acid Frame shift mutation Gene expression Mutation Point mutation Page 41 Page 41 Page 44 Page
Chapter 5: Organization and Expression of Immunoglobulin Genes
Chapter 5: Organization and Expression of Immunoglobulin Genes I. Genetic Model Compatible with Ig Structure A. Two models for Ab structure diversity 1. Germ-line theory: maintained that the genome contributed
Name Date Period. 2. When a molecule of double-stranded DNA undergoes replication, it results in
DNA, RNA, Protein Synthesis Keystone 1. During the process shown above, the two strands of one DNA molecule are unwound. Then, DNA polymerases add complementary nucleotides to each strand which results
How To Understand How Gene Expression Is Regulated
What makes cells different from each other? How do cells respond to information from environment? Regulation of: - Transcription - prokaryotes - eukaryotes - mrna splicing - mrna localisation and translation
Gene and Chromosome Mutation Worksheet (reference pgs. 239-240 in Modern Biology textbook)
Name Date Per Look at the diagrams, then answer the questions. Gene Mutations affect a single gene by changing its base sequence, resulting in an incorrect, or nonfunctional, protein being made. (a) A
Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464
Call for action: Paradigm shift in teaching microbiology in a community colleges Kaustubha Qanungo Ph.D Biological Sciences Trident Technical College 7000 Rivers Avenue Charleston SC 29464 Project Course:
Genomes and SNPs in Malaria and Sickle Cell Anemia
Genomes and SNPs in Malaria and Sickle Cell Anemia Introduction to Genome Browsing with Ensembl Ensembl The vast amount of information in biological databases today demands a way of organising and accessing
What is Cancer? Cancer is a genetic disease: Cancer typically involves a change in gene expression/function:
Cancer is a genetic disease: Inherited cancer Sporadic cancer What is Cancer? Cancer typically involves a change in gene expression/function: Qualitative change Quantitative change Any cancer causing genetic
Algorithms in Computational Biology (236522) spring 2007 Lecture #1
Algorithms in Computational Biology (236522) spring 2007 Lecture #1 Lecturer: Shlomo Moran, Taub 639, tel 4363 Office hours: Tuesday 11:00-12:00/by appointment TA: Ilan Gronau, Taub 700, tel 4894 Office
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools.
Accelerate genomic breakthroughs in microbiology. Gain deeper insights with powerful bioinformatic tools. Empowering microbial genomics. Extensive methods. Expansive possibilities. In microbiome studies
Asexual Versus Sexual Reproduction in Genetic Algorithms 1
Asexual Versus Sexual Reproduction in Genetic Algorithms Wendy Ann Deslauriers ([email protected]) Institute of Cognitive Science,Room 22, Dunton Tower Carleton University, 25 Colonel By Drive
Gene Regulation -- The Lac Operon
Gene Regulation -- The Lac Operon Specific proteins are present in different tissues and some appear only at certain times during development. All cells of a higher organism have the full set of genes:
